ID: 956463913_956463926

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 956463913 956463926
Species Human (GRCh38) Human (GRCh38)
Location 3:69500114-69500136 3:69500156-69500178
Sequence CCCCAGGACCCAGAGCTGTGGCT GTTTGGACAGAGAGCAGGGTGGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 10, 3: 41, 4: 505} {0: 1, 1: 0, 2: 1, 3: 23, 4: 281}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!