ID: 956857243_956857245

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 956857243 956857245
Species Human (GRCh38) Human (GRCh38)
Location 3:73287244-73287266 3:73287257-73287279
Sequence CCTCAAAGCATTGCTGGGAGCAT CTGGGAGCATGAAATGAAGTGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!