ID: 957000500_957000509

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 957000500 957000509
Species Human (GRCh38) Human (GRCh38)
Location 3:74877899-74877921 3:74877945-74877967
Sequence CCTGCCGGATCCGGAGGGATGGA CAGCAAACAGCAGTGGTGGATGG
Strand - +
Off-target summary {0: 13, 1: 74, 2: 167, 3: 150, 4: 138} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!