ID: 957011277_957011285

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 957011277 957011285
Species Human (GRCh38) Human (GRCh38)
Location 3:75008690-75008712 3:75008743-75008765
Sequence CCCTGTGGTGTAGGCACCCGAGG GTTAGAAAAGCGTTGTAGCCAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!