ID: 957695639_957695643

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 957695639 957695643
Species Human (GRCh38) Human (GRCh38)
Location 3:83635597-83635619 3:83635610-83635632
Sequence CCCTGCTCACTTCATTGGGACTG ATTGGGACTGGTTAGACAGTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 15, 3: 278, 4: 1077} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!