ID: 958098896_958098905

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 958098896 958098905
Species Human (GRCh38) Human (GRCh38)
Location 3:88983517-88983539 3:88983556-88983578
Sequence CCCCACCACTGCTAGAAATGTTT TTTAGAAGCAACACATACTTTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 23, 4: 251} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!