ID: 959015821_959015826

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 959015821 959015826
Species Human (GRCh38) Human (GRCh38)
Location 3:101132886-101132908 3:101132918-101132940
Sequence CCTTCCTCATCCCTCTTTTCCAC GAGACAGAAGCTAAAAACCATGG
Strand - +
Off-target summary {0: 24, 1: 33, 2: 46, 3: 144, 4: 1147} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!