ID: 959863802_959863818

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 959863802 959863818
Species Human (GRCh38) Human (GRCh38)
Location 3:111243401-111243423 3:111243452-111243474
Sequence CCAGGTCTGTAGCCATGATTTGG CACCCCAACTTGGAAGGGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 17, 3: 44, 4: 151} {0: 4, 1: 5, 2: 23, 3: 85, 4: 370}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!