ID: 959868578_959868583

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 959868578 959868583
Species Human (GRCh38) Human (GRCh38)
Location 3:111300371-111300393 3:111300401-111300423
Sequence CCTTCCCCTAAGTGCACAAATTC GCATCACATGGCTGCTACCAAGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 41, 3: 134, 4: 364} {0: 1, 1: 0, 2: 5, 3: 45, 4: 354}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!