ID: 959922159_959922164

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 959922159 959922164
Species Human (GRCh38) Human (GRCh38)
Location 3:111880279-111880301 3:111880294-111880316
Sequence CCCCTGATCTAAAGGCAGAATTA CAGAATTAGAGATATGTTTGGGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 23, 3: 91, 4: 284} {0: 1, 1: 1, 2: 4, 3: 37, 4: 314}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!