|
Left Crispr |
Right Crispr |
| Crispr ID |
959963883 |
959963890 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
3:112332561-112332583
|
3:112332607-112332629
|
| Sequence |
CCAGCCTGGACCACAGAGCGAGA |
GGAGAAGAAGGAGAAGGAGAAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 30, 1: 2430, 2: 51528, 3: 155797, 4: 230123} |
{0: 42, 1: 433, 2: 1903, 3: 4832, 4: 14105} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|