ID: 959997856_959997858

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 959997856 959997858
Species Human (GRCh38) Human (GRCh38)
Location 3:112698292-112698314 3:112698317-112698339
Sequence CCTTCCATCTTCTGCAGATAACT TCTCCTTTTGAGAGAGCTCTTGG
Strand - +
Off-target summary {0: 5, 1: 198, 2: 191, 3: 123, 4: 339} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!