|
Left Crispr |
Right Crispr |
| Crispr ID |
960006982 |
960006990 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
3:112790730-112790752
|
3:112790777-112790799
|
| Sequence |
CCCTGCTGCATCTGGAGGGGTGG |
CGGCAAACAGCAGTGGTGGATGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 16, 2: 56, 3: 132, 4: 377} |
{0: 62, 1: 126, 2: 64, 3: 58, 4: 189} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|