|
Left Crispr |
Right Crispr |
| Crispr ID |
960349526 |
960349531 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
3:116575671-116575693
|
3:116575710-116575732
|
| Sequence |
CCTGCCATTTTCTGAAGATAACT |
ACAGCTCTTGGTCTGTTACTGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 15, 2: 209, 3: 211, 4: 316} |
{0: 13, 1: 193, 2: 204, 3: 150, 4: 243} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|