ID: 960465964_960465974

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 960465964 960465974
Species Human (GRCh38) Human (GRCh38)
Location 3:117997080-117997102 3:117997120-117997142
Sequence CCTGTTCCATCCAGAACCGGAGC CCACCCCGGAGCCCGGCGGCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 25, 4: 249}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!