ID: 960465977_960465997

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 960465977 960465997
Species Human (GRCh38) Human (GRCh38)
Location 3:117997124-117997146 3:117997177-117997199
Sequence CCCGGAGCCCGGCGGCAGGGAGG CCTACCTTGCAATGAGAAGAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 15, 4: 128}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!