ID: 960465979_960465995

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 960465979 960465995
Species Human (GRCh38) Human (GRCh38)
Location 3:117997125-117997147 3:117997176-117997198
Sequence CCGGAGCCCGGCGGCAGGGAGGA CCCTACCTTGCAATGAGAAGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 11, 4: 133}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!