ID: 960465985_960465999

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 960465985 960465999
Species Human (GRCh38) Human (GRCh38)
Location 3:117997132-117997154 3:117997182-117997204
Sequence CCGGCGGCAGGGAGGAGGGGGCG CTTGCAATGAGAAGAGGGACAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 21, 4: 237}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!