ID: 960616267_960616275

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 960616267 960616275
Species Human (GRCh38) Human (GRCh38)
Location 3:119598852-119598874 3:119598885-119598907
Sequence CCCTCCCTGCTACAAAGTTCCAC CATGCTCTCCTTGCACTCATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 212} {0: 1, 1: 0, 2: 0, 3: 15, 4: 231}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!