ID: 960616273_960616278

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 960616273 960616278
Species Human (GRCh38) Human (GRCh38)
Location 3:119598871-119598893 3:119598899-119598921
Sequence CCACTGGGTGACTGCATGCTCTC ACTCATGGGTGGTTTTTCAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 194} {0: 1, 1: 0, 2: 2, 3: 6, 4: 115}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!