ID: 960619698_960619706

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 960619698 960619706
Species Human (GRCh38) Human (GRCh38)
Location 3:119626228-119626250 3:119626248-119626270
Sequence CCCCTGCCCAAAGCAGCCACCCA CCACCTGAGCATGCTTCCACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 43, 4: 431} {0: 1, 1: 0, 2: 0, 3: 14, 4: 117}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!