ID: 960864355_960864379

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 960864355 960864379
Species Human (GRCh38) Human (GRCh38)
Location 3:122184544-122184566 3:122184595-122184617
Sequence CCCAAGGAGGGCGGGAGGAAAGC GGTCTGGGGGCCAAGGGCTCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 198} {0: 1, 1: 0, 2: 2, 3: 52, 4: 486}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!