ID: 960864365_960864383

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 960864365 960864383
Species Human (GRCh38) Human (GRCh38)
Location 3:122184568-122184590 3:122184607-122184629
Sequence CCCCTGGTGGGGGAGGGGCCGTG AAGGGCTCCGGGCCGAACGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 46, 4: 399} {0: 1, 1: 0, 2: 0, 3: 0, 4: 28}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!