ID: 961013418_961013426

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 961013418 961013426
Species Human (GRCh38) Human (GRCh38)
Location 3:123449858-123449880 3:123449878-123449900
Sequence CCGCCCCCGGCCTGGCCATGGCC GCCCCAGCCTCGGCGCCCCGCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 5, 3: 77, 4: 640} {0: 1, 1: 1, 2: 2, 3: 56, 4: 1024}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!