ID: 961013421_961013435

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 961013421 961013435
Species Human (GRCh38) Human (GRCh38)
Location 3:123449863-123449885 3:123449894-123449916
Sequence CCCGGCCTGGCCATGGCCCCAGC CCCGCGGGCATCCTCAGGCCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 10, 3: 79, 4: 945} {0: 1, 1: 0, 2: 1, 3: 13, 4: 161}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!