ID: 961075445_961075450

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 961075445 961075450
Species Human (GRCh38) Human (GRCh38)
Location 3:123977755-123977777 3:123977791-123977813
Sequence CCATCTTCCCTCAAAATTTTCAG CTCCTCAATGTTTTGTGGAGTGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 45, 4: 427} {0: 2, 1: 0, 2: 0, 3: 4, 4: 134}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!