ID: 961262844_961262848

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 961262844 961262848
Species Human (GRCh38) Human (GRCh38)
Location 3:125616392-125616414 3:125616438-125616460
Sequence CCCTACCATCTTCTGCAGATAAC CTTGGCCTGTTACTGTGCCTTGG
Strand - +
Off-target summary {0: 7, 1: 193, 2: 178, 3: 130, 4: 224} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!