ID: 961262846_961262848

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 961262846 961262848
Species Human (GRCh38) Human (GRCh38)
Location 3:125616397-125616419 3:125616438-125616460
Sequence CCATCTTCTGCAGATAACTACTC CTTGGCCTGTTACTGTGCCTTGG
Strand - +
Off-target summary No data {0: 1, 1: 3, 2: 185, 3: 191, 4: 306}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!