ID: 961340351_961340358

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 961340351 961340358
Species Human (GRCh38) Human (GRCh38)
Location 3:126213189-126213211 3:126213233-126213255
Sequence CCGGCGGCCGCGGCCCTTCGCCG GCTCAAAAAAGCCGTCTCCATGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!