ID: 961344173_961344181

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 961344173 961344181
Species Human (GRCh38) Human (GRCh38)
Location 3:126251123-126251145 3:126251156-126251178
Sequence CCTAAAATGTATAAAAACTAGTT CCCCATGGGCACATGTTCTCAGG
Strand - +
Off-target summary No data {0: 1, 1: 10, 2: 465, 3: 848, 4: 1387}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!