ID: 961491202_961491221

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 961491202 961491221
Species Human (GRCh38) Human (GRCh38)
Location 3:127257852-127257874 3:127257900-127257922
Sequence CCCATCAGCCCCCAGCCTCCAGC GTGGTGGGGGACCAGCTCCAGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!