ID: 961654734_961654739

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 961654734 961654739
Species Human (GRCh38) Human (GRCh38)
Location 3:128435091-128435113 3:128435107-128435129
Sequence CCTGGCTGTGACTCCCTGGCAGC TGGCAGCTGAGCAACTGGGTAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 20, 4: 210}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!