ID: 962689719_962689724

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 962689719 962689724
Species Human (GRCh38) Human (GRCh38)
Location 3:137882108-137882130 3:137882121-137882143
Sequence CCCCATCAACACCAAGCTGTACC AAGCTGTACCAGAGTGCAGGAGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 3, 3: 8, 4: 121} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!