ID: 962997967_962997970

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 962997967 962997970
Species Human (GRCh38) Human (GRCh38)
Location 3:140650671-140650693 3:140650695-140650717
Sequence CCCTGGCGGCAGCTGCGTGGCAC CAGAGAGAATGTATGTGCTTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 12, 3: 114, 4: 431}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!