ID: 963397000_963397003

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 963397000 963397003
Species Human (GRCh38) Human (GRCh38)
Location 3:144747920-144747942 3:144747961-144747983
Sequence CCTACTGGCCATGAAATGGTTTA ACTGTTGTTCTTTAGTGCAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 118} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!