|
Left Crispr |
Right Crispr |
Crispr ID |
963532540 |
963532545 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
3:146488967-146488989
|
3:146489006-146489028
|
Sequence |
CCATGGAATACTACGCAGCCATA |
TGTCCTTTGCAGGACATGGATGG |
Strand |
- |
+ |
Off-target summary |
{0: 525, 1: 26611, 2: 15857, 3: 8299, 4: 4312} |
{0: 9, 1: 29, 2: 37, 3: 84, 4: 301} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|