|
Left Crispr |
Right Crispr |
| Crispr ID |
963998402 |
963998406 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
3:151738591-151738613
|
3:151738621-151738643
|
| Sequence |
CCAGCTTGATTCCATTCTCCTTG |
CAGGTACACCAATCTAACGTAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 2, 1: 15, 2: 258, 3: 1718, 4: 3852} |
{0: 2, 1: 150, 2: 462, 3: 533, 4: 431} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|