ID: 964487988_964487994

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 964487988 964487994
Species Human (GRCh38) Human (GRCh38)
Location 3:157205767-157205789 3:157205789-157205811
Sequence CCCCAGGGCCCTCTGACTGGCTC CTCACATGTGCTCCAAAAGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 38, 4: 346} {0: 1, 1: 0, 2: 1, 3: 14, 4: 127}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!