|
Left Crispr |
Right Crispr |
| Crispr ID |
964679244 |
964679248 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
3:159318906-159318928
|
3:159318940-159318962
|
| Sequence |
CCAGTAACAGGCCATGAGCTGTC |
AGGTAGTTATCTGCAGAAGATGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 4, 1: 164, 2: 190, 3: 137, 4: 212} |
{0: 2, 1: 17, 2: 210, 3: 218, 4: 278} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|