|
Left Crispr |
Right Crispr |
| Crispr ID |
964842879 |
964842885 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
3:161013567-161013589
|
3:161013603-161013625
|
| Sequence |
CCTGGATATCCTTGTTAACTTTG |
TGTCTAATGTTGACAGTGGGGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 35, 1: 2059, 2: 3016, 3: 4969, 4: 2359} |
{0: 11, 1: 5, 2: 18, 3: 21, 4: 156} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|