ID: 965302051_965302058 |
View in Genome Browser |
Spacer: 1 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 965302051 | 965302058 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 3:167017632-167017654 | 3:167017656-167017678 |
| Sequence | CCCTCCACGGTCTCCCTCTCCCT | TCCCTCTCCCTCTCTCTCCACGG |
| Strand | - | + |
| Off-target summary | {0: 11, 1: 5, 2: 11, 3: 298, 4: 903} | No data |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||