ID: 965302109_965302122 |
View in Genome Browser |
Spacer: 20 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 965302109 | 965302122 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | 3:167017849-167017871 | 3:167017892-167017914 |
Sequence | CCCTCCACGGTCTCCCTCTCCCT | TCCCTCTCCCTCTCCCTCCACGG |
Strand | - | + |
Off-target summary | {0: 11, 1: 5, 2: 11, 3: 298, 4: 903} | No data |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |