ID: 965302127_965302134

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 965302127 965302134
Species Human (GRCh38) Human (GRCh38)
Location 3:167017905-167017927 3:167017929-167017951
Sequence CCCTCCACGGTCTCCCTCTCCCT TCCCTCTCCCTCTCTCTCCACGG
Strand - +
Off-target summary {0: 11, 1: 5, 2: 11, 3: 298, 4: 903} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!