ID: 965708643_965708647

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 965708643 965708647
Species Human (GRCh38) Human (GRCh38)
Location 3:171534771-171534793 3:171534805-171534827
Sequence CCAGTAGCAGGCCAAGAGCTGCT GAGTAGTTATCTGCAGAGGATGG
Strand - +
Off-target summary No data {0: 7, 1: 198, 2: 208, 3: 121, 4: 258}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!