ID: 965874346_965874355

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 965874346 965874355
Species Human (GRCh38) Human (GRCh38)
Location 3:173299270-173299292 3:173299310-173299332
Sequence CCGGGAGGTGGCACTTTCCAGAG TGTGGGGAGGAGCAGGCAGTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 20, 3: 145, 4: 863}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!