ID: 966044327_966044333

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 966044327 966044333
Species Human (GRCh38) Human (GRCh38)
Location 3:175530906-175530928 3:175530951-175530973
Sequence CCAAAGCCCAGTAACAGGCCAAG AGTTATCTGCAGAAGATGGCAGG
Strand - +
Off-target summary {0: 169, 1: 171, 2: 103, 3: 76, 4: 232} {0: 185, 1: 187, 2: 104, 3: 111, 4: 225}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!