ID: 966256156_966256159

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 966256156 966256159
Species Human (GRCh38) Human (GRCh38)
Location 3:177918225-177918247 3:177918255-177918277
Sequence CCTCCTCTTTGCTGAGAGCTGAA CAGGATGACCAGCTGCAGAGAGG
Strand - +
Off-target summary No data {0: 36, 1: 76, 2: 171, 3: 246, 4: 571}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!