|
Left Crispr |
Right Crispr |
| Crispr ID |
966296778 |
966296781 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
3:178432830-178432852
|
3:178432878-178432900
|
| Sequence |
CCATGCTTGTATAGCTTGCAGAG |
TTTATAAATTACCCAGTCTCAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 6, 2: 55, 3: 420, 4: 638} |
{0: 6401, 1: 13084, 2: 14111, 3: 11019, 4: 7181} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|