ID: 966516636_966516645

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 966516636 966516645
Species Human (GRCh38) Human (GRCh38)
Location 3:180828248-180828270 3:180828270-180828292
Sequence CCGGCCGCCTTCTCCTTCCTGTA AGAGGAAGGACTCGGGCACCAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 1, 3: 42, 4: 374} {0: 1, 1: 1, 2: 4, 3: 19, 4: 184}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!