|
Left Crispr |
Right Crispr |
| Crispr ID |
966741887 |
966741890 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
3:183241841-183241863
|
3:183241868-183241890
|
| Sequence |
CCTAGAGACTTGTTGAATGGCTT |
CAAAATGCTGATAGTGATATGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1428, 1: 1886, 2: 1423, 3: 807, 4: 580} |
{0: 38, 1: 78, 2: 68, 3: 54, 4: 259} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|